About 16,579 results found. (Query 0.08300 seconds)
Guns"R"Us – The 2nd Amendment Store
http://7vugm3oxle3e6z5v2snu5fwvbgajqmt2hw3hgqviaafaqd2levfsubid.onion
× Search for: Search Skip to content Guns"R"Us The 2nd Amendment Store All Categories Ammunition Automatic Rifles Pistols Revolvers Rifles Shotguns Search for 0 $ 0.00 No products in the cart.
Silent Link
http://silentlnit5ryavvfz5vw7s4qg62jujd666lnc4tg2chj64zuwuqtvqd.onion/faq
NO NUMBER and IDENTITY eSIMs are one time use only, you cannot reinstall your eSIM to another phone. You would need to purchase another NO NUMBER eSIM and contact us to have your balance and number (if you have one) moved to the new eSIM. When contacting us, please provide both of your old and new order links.
Fabulous new flat in Balerna – 3.5 rooms - Bithome: Buy and Sell Real Estate with Bitcoin...
http://bitrsatnoi7eslht7rkuaptxtkcgs6axaclzfluiijcpghh537j7b5ad.onion?product=richard-mille
Skip to content Bithome: Buy and Sell Real Estate with Bitcoin TG:Bitfundz005 Fabulous new flat in Balerna – 3.5 rooms Fabulous new flat in Balerna – 3.5 rooms Fabulous new flat in Balerna – 3.5 rooms June 5, 2024 post a comment Sale!
SimpleX blog: Security assessment by Trail of Bits, the new website and v4.2 released
http://isdb4l77sjqoy2qq7ipum6x3at6hyn3jmxfx4zdhc72ufbmuq4ilwkqd.onion/blog/20221108-simplex-chat-v4.2-security-audit-new-website.html
So, while we love to be focused on the chat application, we decided to make the new one. We hope that our new website better answers these questions. If you think something should be added/removed/changed - please let us know.
OnionDir - About
http://oniodtu6xudkiblcijrwwkduu2tdle3rav7nlszrjhrxpjtkg4brmgqd.onion/about.php
OnionDir oniodtu6xudkiblcijrwwkduu2tdle3rav7nlszrjhrxpjtkg4brmgqd.onion Home Add About Categories Hosting Forums Private Sites Entertainment Hacking Libraries/Wikis Markets Link Lists Social Other Adult/Erotic Security Search Engine Crypto About OnionDir Everyone can add new links and comment or vote for the sites already available.
Community Surveillance Apps
http://sls.iykpqm7jiradoeezzkhj7c4b33g4hbgfwelht2evxxeicbpjy44c7ead.onion/technologies/community-surveillance-apps
Available at SSRN The rise of fear-based social media like Nextdoor, Citizen, and now Amazon’s Neighbors (Vox) Technologies Privacy Policy Contact Copyright (CC-BY) Follow Us Facebook X RSS Subscribe Share Facebook X Copy Link
Hacking sites .onion dir — Sites .onion
http://ihbiszc7fqnijjiolq7tophfjbzyubcgi4uldr47eqg42cbe4twrofad.onion/hacking-sites-onion-dir.html
Sites Onion Dir Hacking sites .onion dir   http://salted7fpnlaguiq.onion/ - SALT   http://oval6aixoagt6m5z3sythzynv4hwoqye6aynk6hzp3cbfipydxnnzjad.onion/ - Virtual Credit card clone with a limit 3000 to 5000 US$/EUR   http://yj5rbziqttulgidy.onion/ - Itanimulli   http://bbxdfsru7lmmbj32.onion/marketplace/ - Delta Initiative   http://2ogmrlfzdthnwkez.onion/ - Rent-A-Hacker   http://imgbifwwqoixh7te.onion/ - Scam Investigators Been scammed?
EhrenBin
http://bin.habeehrhadazsw3izbrbilqajalfyqqln54mrja3iwpqxgcuxnus7eid.onion
Your browser may require an HTTPS connection to support the WebCrypto API. Try switching to HTTPS . Copy link Editor Preview Create +++ no paste text +++ Tabulator key serves as character (Hit Ctrl + m or Esc to toggle) Discussion Loading… In case this message never disappears please have a look at this FAQ for information to troubleshoot .
2 similar results skipped
Drugs shop — Marketplace Add link
http://dwmzvbke5np7jendbbm56akcwd4ddumaed3ypgtoyn55tubbufamstqd.onion/catalog/1
This cocaine for sale online has been quality tested and is the best quality. This means that if you buy cocaine online from us, you won’t face any problems, if you use it legally, of course. Contact Us on>>>>Contact E-mail:(([email protected] )) ICQ… 747955926 BIO COCAINE 95% PURE $150.00 $90.00 1 gram | 0% | $90 per gram 2 – 4 grams | 5% | $85 per gram 5 – 9 grams | 10% | $80 per gram 10 – 19 grams | 15% | $75 per gram 20 – 49 grams | 20% | $40 per gram 50 – 99...
Buy Dmt: 3.5 Gram (guaranteed Delivery) - DarkHub
http://hubooomjabebx4fntzdx7vg52celbnvk52j6wprrtqpvsdjscnklaeqd.onion/product/SRzBHEGZUcKkYyS1ewsslFOQK2VtG1iS
Please send link to certification credentials. We will NOT send sample without valid certs. Stealth: Items are weigh into plastic 2”x2” size baggies, cleaned, and sealed in Mylar (scan-proof), metal bags, wrap a few layers around for handling, and then put into a shipping envelop.
How to: Use Signal on iOS | Surveillance Self-Defense
http://ssd.iykpqm7jiradoeezzkhj7c4b33g4hbgfwelht2evxxeicbpjy44c7ead.onion/ps/module/guide-pratique-utiliser-signal-pour-ios
Group chat settings with “group link” circled A screen will appear allowing you to enable the group link, and also choose whether new members must be manually approved by a group administrator.
The incredible speed of memchr
http://glfwtfwhlsm2u5pw3b7crist7bt7fwepj2wgv3n3b64unj22v5435tyd.onion/blog/2022/12/10/The-Incredible-speed-of-memchr.html
These file formats are heavily text-based formats, e.g: fasta, .fastq, .sam, .vcf. A very typical operation we apply is finding a new line in a huge buffer. Think of something like: char* str = "ACGTACGTACGTACGTACGTACGT\nACGTACGTACGTACGTACGT\n" // find the position of the next new line So what is the fastest way of finding these new lines?
0.17789524BTC supposed to receive 0.18 - Deepweb Answers
http://muexe2o3hzug5ycmmhiagvmf63x6sqdrirrzouif5mbis5djjceclgad.onion/3597/0-17789524btc-supposed-to-receive-0-18?show=3603
The fee amount can vary based on the congestion of the network and the size of the transaction. answered Dec 24, 2024 by anonymous Your comment on this answer: Your name to display (optional): Email me at this address if a comment is added after mine: Email me if a comment is added after mine Privacy: Your email address will only be used for sending these notifications. market link? answered Feb 19 by se77en you must be browsing dw while sleeping, the link is in the post....
Meta Ads - Reach Customers Online with Ads on Facebook, Instagram, Messenger & WhatsApp | Meta...
http://nn-no.facebookwkhpilnemxj7asaniu7vnjjbiltxjqhye3mhbshg7kx5tfyd.onion/business/ads
Businesses like yours use Meta ads to increase online sales, drive in-store traffic and find new customers. Whether you’re new to online advertising or are an experienced marketer, Meta is here to give you the resources and support you need to succeed.